Eloc (NM_026456) Mouse Untagged Clone

CAT#: MC210654

Tceb1 (untagged) - Mouse transcription elongation factor B (SIII), polypeptide 1 (Tceb1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Eloc
• Synonyms: 2610043E24Rik; 2610301I15Rik; AA407206; AI987979; AW049146; Tceb1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210654 representing NM_026456
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATGGAGAGGAGAAGACCTATGGTGGCTGTGAAGGCCCTGATGCTATGTATGTGAAATTAATATCTT
  CTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCACTAACATCAGGAACAATAAAGGCTATGTTGAG
  TGGTCCAGGTCAGTTTGCTGAGAATGAAACCAACGAGGTCAATTTTAGAGAGATCCCCTCACATGTGCTA
  TCAAAAGTGTGCATGTATTTTACCTACAAGGTCCGCTATACTAACAGCTCCACTGAAATTCCTGAATTCC
  CAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCTGCAAACTTCCTAGATTGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_026456
• ORF Size: 339 bp
• Insert Size: 339
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_026456.4, NP_080732.1
• RefSeq Size: 968
• RefSeq ORF: 339
• Locus ID: 67923
• Gene Summary: The elongin BC complex seems to be involved as an adapter protein in the proteasomal degradation of target proteins via different E3 ubiquitin ligase complexes, including the von Hippel-Lindau ubiquitination complex CBC(VHL). By binding to BC-box motifs it seems to link target recruitment subunits, like VHL and members of the SOCS box family, to Cullin/RBX1 modules that activate E2 ubiquitination enzymes. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.