Rpl41 (NM_018860) Mouse Untagged Clone

CAT#: MC210664

Rpl41 (untagged) - Mouse ribosomal protein L41 (Rpl41), (10ug)


  "NM_018860" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rpl41"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rpl41
Synonyms 1810055P16Rik; 2210411K19Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210664 representing NM_018860
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGAGCGAAGTGGCGGAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGT
CCAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_018860
ORF Size 78 bp
Insert Size 78
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_018860.4, NP_061348.1
RefSeq Size 459
RefSeq ORF 78
Locus ID 67945

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.