Rpl39l (NM_026594) Mouse Untagged Clone

CAT#: MC210700

Rpl39l (untagged) - Mouse ribosomal protein L39-like (Rpl39l), (10ug)


  "NM_026594" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rpl39l"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rpl39l
Synonyms 4930517K11Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210700 representing NM_026594
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCTCACAAGACCTTCAGGATCAAGCGATTCCTGGCCAAGAAACAAAAGCAAAATCGTCCCATTC
CACAATGGATTCAGATGAAAACTGGCAATAAAATCATGTACAACTCCAAGCGGAGACATTGGAGACGAAC
CAAATTGGGTCTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026594
ORF Size 156 bp
Insert Size 156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_026594.2, NP_080870.1
RefSeq Size 805
RefSeq ORF 156
Locus ID 68172

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.