Ucma (NM_001165932) Mouse Untagged Clone
CAT#: MC210738
Ucma (untagged) - Mouse upper zone of growth plate and cartilage matrix associated (Ucma), transcript variant 3, (10ug)
"NM_001165932" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ucma |
Synonyms | 1110017I16Rik; AW121955; Grp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210738 representing NM_001165932
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCTGGAGACGGGTCATTCTCCTGTCATCTCTCTTGGCCCTGGTGCTCCTGTGTATGCTACAGGAGG GGACCAGCGCTTCTGTGGGGAGCAGGCAGGCAGCTGCAGAGGGGGTGCAGGAAGGTGTGAAACAGAAGAT TTTCATGCAAGAATCTGATGCCTCCAATTTCCTCAAGAGGCGTGGCAAGCGGTCTCCTAAGTCCCGAGAT GAAGTTAATGAGCAGGAAGAGAGGACCCGGGAGGCTGTGGAGCAGTGGCGCCAGTGGCATTATGATGGCC TGTATCCTTCCTACCTCTACAACCGCCAAAACATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001165932 |
ORF Size | 318 bp |
Insert Size | 318 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001165932.1, NP_001159404.1 |
RefSeq Size | 785 |
RefSeq ORF | 318 |
Locus ID | 68527 |
Gene Summary | This gene encodes chondrocyte-specific, highly charged proteins that are abundantly expressed during the early stages of chondrogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein that is secreted into the extracellular matrix. The glutamic acid residues in the encoded protein undergo gamma carboxylation in a vitamin K-dependent manner. Despite the implied role in calcification and ossification, mice lacking the encoded protein do not display significant defects in the skeletal development. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo a similar proteolytic processing to generate mature proteins. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (3, also known as Ucma/GRP-F3) contains an alternate in-frame exon in the 5' coding region and lacks an in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a. This isoform (c) may undergo proteolytic processing similar to isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR219966 | Ucma (Myc-DDK-tagged) - Mouse upper zone of growth plate and cartilage matrix associated (Ucma), transcript variant 3 |
USD 200.00 |
|
MG219966 | Ucma (GFP-tagged) - Mouse upper zone of growth plate and cartilage matrix associated (Ucma) transcript variant 3, (10ug) |
USD 220.00 |
|
MR219966L3 | Lenti ORF clone of Ucma (Myc-DDK-tagged) - Mouse upper zone of growth plate and cartilage matrix associated (Ucma), transcript variant 3 |
USD 400.00 |
|
MR219966L4 | Lenti ORF clone of Ucma (mGFP-tagged) - Mouse upper zone of growth plate and cartilage matrix associated (Ucma), transcript variant 3 |
USD 400.00 |
{0} Product Review(s)
Be the first one to submit a review