Fam25c (NM_183278) Mouse Untagged Clone

CAT#: MC210855

Fam25c (untagged) - Mouse family with sequence similarity 25, member C (Fam25c), (10ug)


  "NM_183278" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fam25c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fam25c
Synonyms 2200001I15Rik; Fam25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210855 representing NM_183278
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGGGAGGCCTGGGGAAGCTGGCGGCCGAGGGCCTGGCCCACCGCACAGAGAAAGCCACTGAGGGAG
CAGTTCACGCAGTGGAAGAGGTGGTGAGCGAGGTGGTGGGCCACGCCAAGGAGGTTGGAGAGAAGGCCAT
TAATGACGCCCTAAAGAAAGCCCAAGAATCAGGAGACAGGGTGGTGAAGGAGGTCACTGAGAAGGTCACC
CACACCATCACTGATGCTGTTACCCATGCGGCAGAAGGCCTGGGAAGACTGGGACAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_183278
ORF Size 270 bp
Insert Size 270
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_183278.2, NP_899101.1
RefSeq Size 367
RefSeq ORF 270
Locus ID 69134

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.