Scnm1 (NM_001163573) Mouse Untagged Clone

CAT#: MC210878

Scnm1 (untagged) - Mouse sodium channel modifier 1 (Scnm1), transcript variant 2, (10ug)


  "NM_001163573" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Scnm1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Scnm1
Synonyms 3110001I17Rik; Scnm1-ps
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210878 representing NM_001163573
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTTTTAAGAGGGAAGGGGACGACTGGAGTCAACTCAATGTGCTCAAAAAACGGAGAGTTGGGGACC
TGCTGGCTAGTTACATCCCTGAGGACGAGGCACTGATGCTGCGGGATGGACGCTTTGCTTGTGCCATCTG
CCCCCATCGACCAGTACTAGACACGCTGGCCATGTTGACAGCCCACCGTGCAGGCAAGAAGCATTTGTCC
AGTCTGAAGCTTTTCTATGGCAAAAAGCAAACAGGCAAGGGAACAGAGCAAAATCCAAGACAGCAGAACG
AATTGAAGACAGAAAGCAAAACTGAGGCTCCTTTGCTAACCCAGACTCGAATCATCACCCAGAATGCTCT
ACACAGAGCTCCCCACTATAACAGTTGCTGCCGGAGGAAGCACAGCTCTGGATGGGTCCCAGATGGACGA
GGTCGATGGATAAAGGATGAAAATGTTGAGTTTGACTCTGATGAGGAAGAGCCCCCCGATCTCCCCTTGG
ACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001163573
ORF Size 495 bp
Insert Size 495
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001163573.1, NP_001157045.1
RefSeq Size 693
RefSeq ORF 495
Locus ID 69269
Gene Summary Mutations in the voltage-gated sodium channel gene Scn8a lead to neurological problems in mice. For one particular mutation, Scn8amedJ, mice live to adulthood but have tremors and muscle weakness, among other problems, in all strains except those derived from C57BL6 mice. In these strains, the product of the Scnm1 gene (229 aa) partially overcomes the effects of the Scn8amedJ mutation. However, in C57BL6-derived mice, a one nt change in the penultimate exon creates a premature stop codon, truncating the Scnm1 protein at 186 aa. This truncated protein lacks the ability to overcome the effects of the Scn8amedJ mutation, and these mice suffer paralysis and juvenile death. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (2) lacks the exon containing the stop codon compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.