Pxt1 (NM_153390) Mouse Untagged Clone

CAT#: MC210890

Pxt1 (untagged) - Mouse peroxisomal, testis specific 1 (Pxt1), (10ug)


  "NM_153390" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pxt1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pxt1
Synonyms 1700001G18Rik; Stepp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210890 representing NM_153390
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCTTAGACACATTGGGGACAGTGTCAATCACAGGGTGATTCAGGAGCATCTTGCACAGGAAGTCG
GAGATGTGCTGGCTCCTTTTGTGGCGCTGGTGTTCGTGAGAGGCCAGGTGCTGCTGAGATTTTTCTGGAA
CAACCATTTGCTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_153390
ORF Size 156 bp
Insert Size 156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_153390.1, NP_700439.1
RefSeq Size 1015
RefSeq ORF 156
Locus ID 69307

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.