Dynlrb2 (NM_029297) Mouse Untagged Clone

CAT#: MC211635

Dynlrb2 (untagged) - Mouse dynein light chain roadblock-type 2 (Dynlrb2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dynlrb2
• Synonyms: 1700009A04Rik; Dncl2b; DNLC2B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NM_029297.1
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACAGAAGTGGAGGAAACCCTCAAGAGAATCCAGAGTCACAAAGGGGTCATCGGAACGATGGTGGTCA
  ATGCAGAAGGCATTCCAATCCGAACAACCCTGGACAACTCCACAACGGTTCAGTATGCGGGTCTTCTCCA
  CCAGCTGACCATGAAAGCCAAGAGCACAGTCAGGGATATTGACCCCCAGAACGACCTGACTTTTCTTAGG
  ATCAGATCGAAGAAACATGAAATCATGGTAGCCCCAGATAAGGAATATCTTCTGATTGTCATTCAGAACC
  CATGTGAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_029297
• ORF Size: 291 bp
• Insert Size: 291
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_029297.1, NP_083573.1
• RefSeq Size: 515
• RefSeq ORF: 291
• Locus ID: 75465
• Gene Summary: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. [UniProtKB/Swiss-Prot Function]