Cox8c (NM_001039049) Mouse Untagged Clone

CAT#: MC211643

Cox8c (untagged) - Mouse cytochrome c oxidase, subunit VIIIc (Cox8c), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_001039049" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cox8c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox8c
Synonyms 1700007F21Rik; COX8-3; COXVIII-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211643 representing NM_001039049
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCGCCTGCTGCTACTCTGCTCTTCGCTCCTCCGCCACCGTGCAGTCCTGTTCTCGAAGCCTGGCC
ACCCAGGCCGCCTCAGCCACTCAGAAAGCCCACAAAAAAAAATCCTGTCGCCCACGGAATCAGCTGTTGG
GATTGTCGTGTTTTTTACGACCTTTTACATCCCAGCTGCATATGTGCTAAGCAGTCTGAAGTATTTCAAA
GGAGAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001039049
ORF Size 219 bp
Insert Size 219
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001039049.1, NP_001034138.1
RefSeq Size 476
RefSeq ORF 219
Locus ID 75483

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.