Smlr1 (NM_001195596) Mouse Untagged Clone

CAT#: MC211669

Smlr1 (untagged) - Mouse RIKEN cDNA 2010003K15 gene (2010003K15Rik), (10ug)


  "NM_001195596" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Smlr1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Smlr1
Synonyms 2010003K15Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211669 representing NM_001195596
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTCCGTGCTGGCAATCTTCTTGCAGGAACTCCCCGGCCCTGTCCTGGTCCTGGGGATCTTCCTGC
CTGTGACCTTGCTGCTTCTCCTCCTTCTTGCCTACTTCAGGATCAAACTGATGGCAGTTGAAGAAGAACT
GGCTCACACTTCTGATCGCCAGAACAAGTTTGGTTCTTCCCTGCGCAAGAGAATGAGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001195596
ORF Size 201 bp
Insert Size 201
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001195596.1, NP_001182525.1
RefSeq Size 674
RefSeq ORF 201
Locus ID 100504474

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.