Tmsb15a (NM_030106) Mouse Untagged Clone

CAT#: MC211888

Tmsb15a (untagged) - Mouse thymosin beta 15a (Tmsb15a), (10ug)


  "NM_030106" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tmsb15a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tmsb15a
Synonyms 1700129I15Rik; Tb15a; Tmsbl1; Tmsl8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211888 representing NM_030106
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTGATAGACCAGACTTGTCGGAAGTGGAGAGATTCGATAAATCCAAACTGAAGAAAACCATCACCG
AAGTAAAAAATACTCTGCCCTCGAAGGAAACCATCGAGCAAGAGAAGGAGTTTGTGAAAAGATCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_030106
ORF Size 138 bp
Insert Size 138
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_030106.2, NP_084382.1
RefSeq Size 299
RefSeq ORF 138
Locus ID 78478

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.