Pde6h (NM_023898) Mouse Untagged Clone

CAT#: MC211893

Pde6h (untagged) - Mouse phosphodiesterase 6H, cGMP-specific, cone, gamma (Pde6h), (10ug)


  "NM_023898" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pde6h"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pde6h
Synonyms A930033D18Rik; PDEgamma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211893 representing NM_023898
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGACAGCCCTTCCCTGAGTCCTCCAGCACCAAGCCAGGGCCCTACTACCCCACGCAAAGGGCCCC
CCAAGTTCAAGCAGAGGCAGACTCGACAGTTCAAGAGCAAGCCTCCCAAGAAAGGGGTGAAAGGGTTTGG
AGATGACATCCCAGGCATGGAGGGGCTAGGAACAGATATCACGGTCATCTGTCCCTGGGAAGCGTTCAGC
CATCTGGAGCTGCATGAGCTTGCTCAGTTCGGGATCATATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023898
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_023898.4, NP_076387.2
RefSeq Size 574
RefSeq ORF 252
Locus ID 78600
Gene Summary Participates in processes of transmission and amplification of the visual signal. cGMP-PDEs are the effector molecules in G-protein-mediated phototransduction in vertebrate rods and cones. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.