Mrpl43 (NM_053164) Mouse Untagged Clone

CAT#: MC212006

Mrpl43 (untagged) - Mouse mitochondrial ribosomal protein L43 (Mrpl43), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mrpl43
• Synonyms: 4930442D21Rik; bMRP36a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212006 representing NM_053164
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACCGGTCGCGGGACTTCGAGCCGCTTTCTGACCAGCGTCCTCCATAATGGGCTAGGGCGTTACGTGC
  AGCAGCTGCAGCGCCTCAGCCTCAGCCTCAGCCGGGATGCGCCCTCGTCCCGCGGCGCCAGGGAGTTCGT
  GGAACGCGAGGTGACCGACTTCGCCCGACGGAACCCAGGAGTCGTAGTATACGTGAACCCGCGCCCGTGC
  GCCATGCCACGAATAGTGGCCGAATACCTTAATGGGGCTGTGCGCGAGGAAAACGTCAACAGCAAGTCGG
  TGGAGGAGATCAAGTCGTTGGTGCAGAAGCTGGCAGACCAGTCCGGCTTGGATGTGATCCGCATCCGCAA
  GCCCTTCCACACGGACAACCCGAGCATCCAGGGCCAGTGGCACCCCTTCACCAACAAACGGACTGCCCTC
  CACGGGCTGCGGCCCAGAGAACTCCGGGATTCTGCTCCAGCTTCGATGCAAGCACAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_053164
• ORF Size: 480 bp
• Insert Size: 480
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_053164.3, NP_444394.1
• RefSeq Size: 1213
• RefSeq ORF: 480
• Locus ID: 94067
• Gene Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]