Hmgn3 (NM_175074) Mouse Untagged Clone

CAT#: MC212017

Hmgn3 (untagged) - Mouse high mobility group nucleosomal binding domain 3 (Hmgn3), transcript variant b, (10ug)


  "NM_175074" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hmgn3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hmgn3
Synonyms 1110002A15Rik; 6330514M13Rik; BB071015; TRIP7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212017 representing NM_175074
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAAGAGAAAGTCTCCCGAGAACACAGAGGGCAAAGATGGAACCAAGCTAACTAAGCAGGAGCCCA
CAAGACGGTCGGCCAGGTTGTCCGCGAAACCTGTTCCACCAAAACCGGAGTCTAAACCAAGAAAAACATC
AGCTAAGAAAGAACCTGGAACAAAGATTAGCAGAGGTGCTAAGGGGAAGAAGGAAGAAAAGCAGGAAGCT
GGAGAGGAAGGCACAGAGAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_175074
ORF Size 234 bp
Insert Size 234
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_175074.2, NP_778249.1
RefSeq Size 882
RefSeq ORF 234
Locus ID 94353

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.