Ypel1 (NM_023249) Mouse Untagged Clone

CAT#: MC212124

Ypel1 (untagged) - Mouse yippee-like 1 (Drosophila) (Ypel1), (10ug)


  "NM_023249" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ypel1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ypel1
Synonyms 0610009L05Rik; 1700016N17Rik; 1700019O22Rik; 4921520K19Rik; 4930511F14Rik; AV118478; DGL-1; Dgl1; mdgl-1; Ppil2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212124 representing NM_023249
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAAAATGACCAAGTCCAAAACTTTCCAAGCTTATCTGCCACACTGTCACCGAACTTACAGCTGCA
TCCACTGCAGAGCCCATCTGGCCAATCACGATGAGCTTATCTCCAAGTCCTTTCAGGGAAGCCAGGGGCG
AGCCTACCTCTTCAACTCTGTGGTGAATGTGGGCTGTGGCCCCGCTGAGGAGAGAGTCCTTCTAACCGGG
CTGCATGCAGTGGCCGACATCTACTGTGAGAACTGCAAGACCACACTCGGGTGGAAATACGAACATGCCT
TTGAGAGCAGTCAGAAATACAAGGAAGGAAAATTTATTATTGAACTTGCCCACATGATCAAAGACAACGG
CTGGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023249
ORF Size 357 bp
Insert Size 357
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_023249.6, NP_075738.1
RefSeq Size 2879
RefSeq ORF 357
Locus ID 106369
Gene Summary May play a role in epithelioid conversion of fibroblasts. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.