Dio3 (NM_172119) Mouse Untagged Clone

CAT#: MC212145

Dio3 (untagged) - Mouse deiodinase, iodothyronine type III (Dio3), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Symbol: Dio3
• Synonyms: MGC124117; MGC124118
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212145 representing NM_172119
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCTCGCCAGGCCGCCTCGAGGTTGGTGGTCGGAGAAGGTGAAGGGCCCCCGGGGGCTTCGGGGCCCG
  CGGCCACCATGCTCCGCTCTCTGCTGCTTCACTCGCTGAGGCTCTGCGCCCAGACCGCCTCGTGCCTCGT
  GCTGTTCCCGCGCTTCCTAGGCACGGCCTTCATGCTCTGGCTTTTAGATTTCTTGTGCATCCGCAAGCAT
  TTCCTGCGCCGTCGCCATCCTGACCACCCTGAGCCCGAAGTAGAGCTCAACAGTGAAGGCGAGGAGATGC
  CCCCTGACGACCCGCCCATATGCGTATCAGACGACAACCGTCTGTGCACCCTGGCCTCTCTCAAAGCCGT
  GTGGCATGGCCAGAAATTGGATTTCTTCAAGCAAGCCCATGAGGGTGGCCCAGCGCCCAACTCGGAGGTT
  GTCCGACCTGATGGCTTCCAGAGCCAGCGCATCCTCGACTACGCACAAGGGACCCGCCCGTTGGTGCTCA
  ATTTTGGCAGCTGTACCTGACCACCGTTCATGGCGCGGATGAGCGCCTTCCAGCGCCTGGTCACCAAGTA
  CCAGCGCGACGTTGACTTCCTTATCATCTACATCGAGGAAGCCCACCCATCCGACGGCTGGGTCACCACA
  GATTCACCCTATGTCATCCCCCAGCACCGCAGCCTGGAGGACCGTGTCAGCGCAGCGAGAGTACTACAAC
  AAGGTGCACCTGGCTGTGCTCTGGTCCTGGACACTATGGCCAACTCTAGCAGTTCCGCATATGGTGCCTA
  TTTTGAGCGCCTCTACGTCATCCAGAGTGGCACCATCATGTACCAGGGAGGCCGTGGCCCCGACGGTTAC
  CAGGTGTCTGAGTTGCGCACTTGGTTGGAGCGCTATGATGAACAGTTGCATGGTACTAGGCCACATCGAT
  TCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_172119
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_172119.2, NP_742117.2
• RefSeq Size: 1872
• RefSeq ORF: 915
• Locus ID: 107585
• Gene Summary: This is an intronless, imprinted gene that is preferentially expressed from the paternal allele in the mouse fetus. The encoded protein belongs to the iodothyronine deiodinase family, and catalyzes the inactivation of thyroid hormone by inner ring deiodination of the prohormone thyroxine (T4) and the bioactive hormone 3,3',5-triiodothyronine (T3) to inactive metabolites, 3,3',5' triiodothyronine (RT3) and 3,3'-diiodothyronine (T2), respectively. It is highly expressed in placenta, fetal and neonatal tissues, and thought to prevent premature exposure of developing fetal tissues to adult levels of thyroid hormones. It thus plays a critical role in mammalian development by regulating circulating fetal thyroid hormone concentration. Knockout mice lacking this gene exhibit severe abnormalities related to development and reproduction. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jun 2016]