Srsf9 (NM_025573) Mouse Untagged Clone

CAT#: MC212161

Srsf9 (untagged) - Mouse serine/arginine-rich splicing factor 9 (Srsf9), transcript variant 1, (10ug)


  "NM_025573" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Srsf9"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Srsf9
Synonyms 25kDa; 2610029M16Rik; Sfrs9; SRp30c
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212161 representing NM_025573
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGTCGGGCTGGGCGGACGAGCGCGGCGGCGAGGGCGACGGGCGCATCTACGTGGGCAACCTTCCGT
CCGACGTGCGCGAGAAGGACCTCGAGGACTTGTTCTACAAGTACGGCCGCATCCGCGAGATCGAGCTCAA
GAACCGGCACGGCCTCGTGCCCTTCGCCTTCGTGCGCTTCGAGGACCCGCGAGATGCTGAGGATGCGATC
TATGGAAGAAACGGTTACGATTATGGCCAGTGTCGACTCCGTGTGGAGTTCCCCAGGACTTACGGAGGTC
GGGGTGGGTGGCCCCGTGGTGCAAGGAACGGGCCTCCTACAAGACGGTCAGATTTCCGAGTTCTTGTTTC
AGGACTTCCTCCATCAGGCAGCTGGCAGGACCTGAAAGATCACATGCGAGAAGCTGGGGATGTCTGTTAT
GCAGACGTACAGAAGGACGGAATGGGGATGGTTGAATATTTGAGAAAAGAGGACATGGAATATGCTCTGC
GTAAACTGGATGACACCAAATTCCGCTCTCACGAGGGTGAGACTTCCTACATCCGAGTGTATCCTGAGAG
AAGCACCAGCTATGGCTACTCACGGTCGCGGTCTGGGTCCAGGGGCCGCGACTCGCCATACCAAAGCCGG
GGCTCGCCACACTACTTCTCTCCTTTCAGGCCCTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025573
ORF Size 669 bp
Insert Size 669
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_025573.3, NP_079849.1
RefSeq Size 1162
RefSeq ORF 669
Locus ID 108014
Gene Summary The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (1) represents the protein-coding transcript. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.