Fxyd4 (NM_001173372) Mouse Untagged Clone

CAT#: MC212163

Fxyd4 (untagged) - Mouse FXYD domain-containing ion transport regulator 4 (Fxyd4), transcript variant 2, (10ug)


  "NM_001173372" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fxyd4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fxyd4
Synonyms 0610008I02Rik; AI267073; Chif
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212163 representing NM_001173372
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAAATCACCTGTGCCTTTCTCCTGCTGCTAGCAGGTCTGCCGGCCTTGGAAGCCAGTGACCCAG
TTGATAAAGACAGTCCCTTCTACTATGACTGGGAGAGCCTGCAGCTGGGAGGATTGATTTTTGGAGGGCT
CCTGTGCATCGCTGGAATTGCCATGGCCCTGAGTGGCAAGTGCAAATGTAGGCGTACCCATAAGCCCAGT
TCCTTACCTGGAAAAGCCACTCCACTCATCATTCCAGGCTCTGCCAATACCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001173372
ORF Size 267 bp
Insert Size 267
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001173372.1, NP_001166843.1
RefSeq Size 551
RefSeq ORF 267
Locus ID 108017
Gene Summary This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.