Npy (NM_023456) Mouse Untagged Clone

CAT#: MC212210

Npy (untagged) - Mouse neuropeptide Y (Npy), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Npy
• Synonyms: 0710005A05Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_023456, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTAGGTAACAAGCGAATGGGGCTGTGTGGACTGACCCTCGCTCTATCTCTGCTCGTGTGTTTGGGCA
  TTCTGGCTGAGGGGTACCCCTCCAAGCCGGACAATCCGGGCGAGGACGCGCCAGCAGAGGACATGGCCAG
  ATACTACTCCGCTCTGCGACACTACATCAATCTCATCACCAGACAGAGATATGGCAAGAGATCCAGCCCT
  GAGACACTGATTTCAGACCTCTTAATGAAGGAAAGCACAGAAAACGCCCCCAGAACAAGGCTTGAAGACC
  CTTCCATGTGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_023456
• ORF Size: 294 bp
• Insert Size: 294
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC043012, AAH43012
• RefSeq Size: 561
• RefSeq ORF: 294
• Locus ID: 109648
• Gene Summary: This gene encodes a neuropeptide that plays a pivotal role in many physiological functions such as food intake, energy homeostasis, circadian rhythm, and cognition. The encoded protein precursor undergoes proteolytic processing to generate the biologically active peptide. Mice lacking the encoded protein exhibit mild seizures occasionally and become hyperphagic following food deprivation. A deficiency of the encoded protein partially prevents mice lacking leptin from becoming obese. [provided by RefSeq, Oct 2015]