Srsf1 (NM_001078167) Mouse Untagged Clone

CAT#: MC212234

Srsf1 (untagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Srsf1
• Synonyms: 1110054N12Rik; 5730507C05Rik; 6330415C05Rik; AI482334; Asf; AW491331; Sf2; Sfrs1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212234 representing NM_001078167
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGGGAGGTGGTGTGATCCGTGGCCCGGCGGGGAACAACGACTGCCGCATCTACGTGGGTAACCTAC
  CTCCGGATATCCGAACCAAGGACATCGAGGACGTGTTTTACAAATACGGCGCCATCCGCGACATCGACCT
  GAAGAACCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGATGCG
  GTGTACGGTCGCGACGGCTACGACTACGACGGCTACCGGCTGCGGGTAGAGTTTCCCCGAAGCGGCCGCG
  GGACCGGCCGAGGCGGCGGCGGGGGTGGAGGCGGCGGCGCCCCGAGAGGCCGCTATGGCCCGCCGTCCAG
  GCGGTCCGAGAACAGAGTGGTTGTCTCTGGACTGCCTCCGAGTGGAAGCTGGCAGGACTTAAAGGATCAC
  ATGCGTGAGGCAGGTGATGTATGTTACGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAGTTTGTAC
  GGAAAGAAGATATGACGTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCACGAGGTAGGTTA
  TACACTTATTCTTTTTTTTGGCCAGAATTGGATACAGTTTTCTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001078167
• ORF Size: 606 bp
• Insert Size: 606
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001078167.2, NP_001071635.1
• RefSeq Size: 5560
• RefSeq ORF: 606
• Locus ID: 110809
• Gene Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
  Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.