Olfr78 (NM_130866) Mouse Untagged Clone

CAT#: MC212318

Olfr78 (untagged) - Mouse olfactory receptor 78 (Olfr78), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Olfr78
• Synonyms: 4633402A21Rik; MOL2.3; MOR18-2; Or51e2; PSGR; RA1c
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212318 representing NM_130866
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTTCCTGCAACTTCACCCATGCCACCTTCCTGCTTATTGGTATTCCAGGACTGGAGGAAGCTCACT
  TTTGGTTTGGCTTCCCCCTGCTTTCCATGTATGCTGTAGCATTGTTTGGAAACTGCATTGTGGTCTTCAT
  AGTGAGAACAGAGCGGAGCCTGCATGCACCCATGTACCTTTTTCTCTGCATGCTGGCAGCTATTGATCTG
  GCTTTGTCCACATCCACAATGCCCAAGATTCTCGCCCTCTTTTGGTTTGACTCCCGGGAGATTACTTTTG
  ATGCCTGTCTTGCCCAGATGTTTTTCATTCATACTCTCTCAGCAATTGAATCTACTATCCTGCTGGCCAT
  GGCCTTTGACCGGTACGTGGCTATCTGCCACCCACTGCGTCACGCTGCTGTCCTCAACAATACAGTAACA
  GTCCAAATAGGCATGGTGGCTCTGGTCCGGGGATCCCTATTCTTTTTCCCACTCCCACTACTGATCAAGC
  GACTGGCTTTCTGTCACTCCAATGTGCTCTCCCACTCCTATTGTGTCCACCAGGATGTGATGAAGTTGGC
  CTATACAGACACATTACCCAATGTAGTCTATGGTCTAACTGCCATTCTGCTAGTCATGGGTGTAGATGTC
  ATGTTCATCTCCTTGTCCTACTTCCTGATCATACGAACGGTTCTGCAACTGCCTTCCAAGTCTGAGCGAG
  CTAAGGCATTTGGGACTTGTGTGTCACACATTAGTGTGGTCCTGGCTTTCTATGTACCACTCATTGGTCT
  GTCAGTGGTGCACCGTTTTGGAAACAGCCTGGATCCCATTGTGCATGTTCTAATGGGGGATGTCTACCTG
  CTGCTGCCTCCTGTGATCAATCCCATCATCTACGGTGCTAAGACCAAACAGATCAGAACACGGGTTCTGG
  CTATGTTCAAGATCAGCTGTGACAAGGACATTGAAGCTGGGGGAAACACGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_130866
• ORF Size: 963 bp
• Insert Size: 963
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_130866.4, NP_570936.1
• RefSeq Size: 3496
• RefSeq ORF: 963
• Locus ID: 170639
• Gene Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.