Krtap19 (NM_133359) Mouse Untagged Clone

CAT#: MC212345

Krtap19 (untagged) - Mouse cDNA sequence AY026312 (AY026312), (10ug)


  "NM_133359" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Krtap19"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Krtap19
Synonyms Krtap16-10b; Krtap16.10L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212345 representing NM_133359
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTACTACTACGGCAACTACTATGGTGGCCTTGGCTATGGCCTTGGTGGCTTTGGTGGCTTTGGTG
GCCTGGGATATGGCTATGGTTCCAGCTATGGCCTTGGGGGCTATGGTGGCTATGGCTACTTCAGTCCCTC
TTTCTATGGAGGATATTTGTCTTCTGGGTTTTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133359
ORF Size 177 bp
Insert Size 177
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_133359.2, NP_579937.1
RefSeq Size 461
RefSeq ORF 177
Locus ID 170939

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.