Ucn2 (NM_145077) Mouse Untagged Clone

CAT#: MC212434

Ucn2 (untagged) - Mouse urocortin 2 (Ucn2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ucn2
• Synonyms: Ucn-2; ucn-II; Ucn II
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212434 representing NM_145077
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGACCAGGTGGGCACTGGTGGTGTTCGTGGTCCTGATGTTGGATAGGATCCTATTTGTCCCAGGAA
  CTCCTATCCCCACCTTCCAGCTCCTCCCTCAGAACTCTCTGGAGACAACTCCTAGCTCTGTGACCTCAGA
  GAGCTCCTCAGGTACCACCACAGGACCCTCAGCTTCCTGGAGCAACTCTAAAGCCAGCCCTTACCTAGAC
  ACCCGTGTCATACTCTCCCTGGATGTTCCCATTGGCCTCCTACGGATCTTACTGGAACAGGCTCGTTACA
  AGGCTGCCAGGAATCAGGCTGCCACTAATGCTCAAATACTAGCCCATGTTGGCCGCCGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_145077
• ORF Size: 342 bp
• Insert Size: 342
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_145077.1, NP_659543.1
• RefSeq Size: 1002
• RefSeq ORF: 342
• Locus ID: 171530
• Gene Summary: This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. Mice lacking the encoded protein exhibit increased insulin sensitivity and were protected against fat-induced insulin resistance. In addition, female mice lacking the encoded protein exhibit a significant increase in the basal daily rhythms of adrenocorticotropic hormone and corticosterone, and a significant decrease in fluid intake and depressive-like behavior. [provided by RefSeq, Sep 2016]