Wfdc15b (NM_138685) Mouse Untagged Clone

CAT#: MC212442

Wfdc15b (untagged) - Mouse WAP four-disulfide core domain 15B (Wfdc15b), transcript variant 1, (10ug)


  "NM_138685" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Wfdc15b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Wfdc15b
Synonyms 9230106L14Rik; SWAM1; Wfdc15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212442 representing NM_138685
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTGCTTGGCCTCTCTCTACTCGCAGTGACCATTCTGCTTTGCTGTAACATGGCTCGACCTGAAA
TAAAGAAGAAGAACGTTTTTTCCAAACCTGGCTATTGCCCAGAGTATCGGGTTCCCTGCCCCTTTGTCCT
TATACCTAAATGCAGGCGTGATAAAGGCTGCAAGGACGCCCTGAAGTGTTGCTTCTTCTACTGCCAGATG
CGCTGTGTGGATCCATGGGAGAGCCCAGAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_138685
ORF Size 243 bp
Insert Size 243
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_138685.2, NP_619626.1
RefSeq Size 585
RefSeq ORF 243
Locus ID 192201

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.