Adm2 (NM_182928) Mouse Untagged Clone

CAT#: MC212713

Adm2 (untagged) - Mouse adrenomedullin 2 (Adm2), (10ug)


  "NM_182928" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Adm2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Adm2
Synonyms Am2; IMD; Imdn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212713 representing NM_182928
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCAGTTGCTGATGGTCACGGTAACCCTCGGTTGCATCAGCCTCCTCTACCTGCTCCCCGGCACGT
TGTCTGGCAGCCTGGGCAAGGGACTGAGGCACTCCAGACCCAGAGAGCCCCCAGCTAAGATTCCTTCCAG
TAACCTGCAGCCTGGACACCCTTCCCTTCAGCCTGTAGTCTGGAAGTCTCGTCGTCATGCCCCCCAGCCA
CAGGGAAGGGGCAACAGGGCCCTTGCTATGGTTCATCTGCCTCAGGGTGGTGGCTCACGACACCCTGGTC
CCCAGCGTCCCACGGGATCCCGAAGACCCCATGCCCAGCTCCTGCGGGTTGGCTGTGTACTGGGTACATG
CCAAGTCCAGAATCTTAGCCATCGCCTGTGGCAGCTTGTCCGGCCAGCTGGCCGGCGGGACTCAGCTCCT
GTGGATCCCAGCAGCCCCCACAGTTATGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_182928
ORF Size 453 bp
Insert Size 453
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_182928.5, NP_891558.1
RefSeq Size 1300
RefSeq ORF 453
Locus ID 223780
Gene Summary This gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis, prolactin release, anti-diuresis, anti-natriuresis, and regulation of food and water intake. The encoded protein is proteolytically processed to generate one or more biologically active peptides. Intravenous injection of the active peptide was found to protect mouse lungs from ischemia/reperfusion injury. [provided by RefSeq, Aug 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.