Smox (NM_001177840) Mouse Untagged Clone

CAT#: MC212827

Smox (untagged) - Mouse spermine oxidase (Smox), transcript variant 9, (10ug)


  "NM_001177840" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Smox"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Smox
Synonyms B130066H01Rik; PAO; PAOh1; SMO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212827 representing NM_001177840
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAAGTTGTGAATCCAGTGGCGACAGTGCGGATGACCCTCTCAGTCGTGGCCTACGGAGAAGGGGAC
AGCCTCGTGTGGTGGTGATCGGTGCTGGCTTGGCTGGCCTGGCTGCAGCTAGAGCCCTTCTGGAGCAGGG
CTTCACGGATGTCACTGTGCTTGAGGCTTCCAGCCACATTGGGGGCCGTGTGCAGAGTGTGAGGCTTGGA
GACACCACCTTTGAGCTGGGAGCCACCTGGATCCATGGATCCCACGGGAATCCTATCTATCAACTAGCAG
AAGCCAATGGCCTTTTGGAAGAGACAACAGATGGGGAGCGCAGTGTGGGCCGCATCAGCCTTTACTCCAA
GAATGGCGTGGCCTGCTACCTTACCAACCGTGGCTGCCGCATCCCCAAGGACGTGGTTGAGGAATTCAGC
GATTTATACAACGAGCCCATGCAGGTGCTCTTCTCCGGGGAGGCCACACACCGCAAGTACTACTCCACCA
CCCACGGTGCTCTGCTCTCTGGCCAGCGCGAGGCCGCCCGGCTCATCGAGATGTACCGAGACCTCTTCCA
GCAGGGGCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177840
ORF Size 573 bp
Insert Size 573
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001177840.1, NP_001171311.1
RefSeq Size 1095
RefSeq ORF 573
Locus ID 228608
Gene Summary Flavoenzyme which catalyzes the oxidation of spermine to spermidine. Can also use N(1)-acetylspermine and spermidine as substrates, with different affinity depending on the isoform (isozyme) and on the experimental conditions. Plays an important role in the regulation of polyamine intracellular concentration and has the potential to act as a determinant of cellular sensitivity to the antitumor polyamine analogs. May contribute to beta-alanine production via aldehyde dehydrogenase conversion of 3-amino-propanal. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (9) lacks four alternate exons but maintains the reading frame, compared to variant 1. The resulting protein (isoform i) is shorter when it is compared to isoform a. This transcript has also been called 'splice variant delta'.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.