Nppa (NM_008725) Mouse Untagged Clone

CAT#: MC212904

Nppa (untagged) - Mouse natriuretic peptide type A (Nppa), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nppa
• Synonyms: Anf; ANP; Pnd
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212904 representing NM_008725
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCTCCTTCTCCATCACCCTGGGCTTCTTCCTCGTCTTGGCCTTTTGGCTTCCAGGCCATATTGGAG
  CAAATCCTGTGTACAGTGCGGTGTCCAACACAGATCTGATGGATTTCAAGAACCTGCTAGACCACCTGGA
  GGAGAAGATGCCGGTAGAAGATGAGGTCATGCCCCCGCAGGCCCTGAGTGAGCAGACTGAGGAAGCAGGG
  GCCGCACTTAGCTCCCTCCCCGAGGTGCCTCCCTGGACTGGGGAGGTCAACCCACCTCTGAGAGACGGCA
  GTGCTCTAGGGCGCAGCCCCTGGGACCCCTCCGATAGATCTGCCCTCTTGAAAAGCAAACTGAGGGCTCT
  GCTCGCTGGCCCTCGGAGCCTACGAAGATCCAGCTGCTTCGGGGGTAGGATTGACAGGATTGGAGCCCAG
  AGTGGACTAGGCTGCAACAGCTTCCGGTACCGAAGATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008725
• ORF Size: 459 bp
• Insert Size: 459
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_008725.3, NP_032751.1
• RefSeq Size: 844
• RefSeq ORF: 459
• Locus ID: 230899
• Gene Summary: This gene encodes members of the natriuretic family of peptides that play an important role in the control of extracellular fluid volume and electrolyte homeostasis. The encoded protein precursor undergoes proteolytic processing to generate multiple functional peptides. Mice lacking the encoded peptides exhibit salt-sensitive hypertension. The transgenic overexpression of the encoded peptides in mice decreases arterial blood pressure without inducing diuresis and natriuresis. This gene is located adjacent to another member of the natriuretic family of peptides on chromosome 4. [provided by RefSeq, Oct 2015]