Cytl1 (NM_001081106) Mouse Untagged Clone

CAT#: MC212918

Cytl1 (untagged) - Mouse cytokine-like 1 (Cytl1), (10ug)


  "NM_001081106" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cytl1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cytl1
Synonyms 4Cytl1; 4930443F05Rik; C17; Cyt1; Gm147
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212918 representing NM_001081106
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCACCAAAGACACTACCTCTGTTGCTGCTGCTGGTGGTGGTGGTGATAGCCTGGCCTCTGGCAGTAC
AGTCCGCGCCCCCCACCTGCTACTCTCGGATGCTGACCCTGAGCCGTGAGATCATGGCAGACTTCCAGAG
CCTGCAGGCTTCAGAGCCTGAGGATTCCTGTGTGAGGTACTTGCCCCGGCTTTACCTGGACATCCATAAC
TACTGTGTGCTGGCCAAGCTGAGAGACTTCGTGGCTTCTCCTCAGTGCTGGAAGATGGCCGAAGTGGACA
CTCTGAAGGACAGAGTGCGGAAGCTGTATACCATCATGAACTCCTTCTGCAGGCGGGACTTGGTATTCCT
CTCAGATGACTGCAGTGCCTTAGAAGACCCAATTCCCGAGGCCACGGGTCCTCCAGACTGGCAGAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001081106
ORF Size 420 bp
Insert Size 420
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_001081106.1, NP_001074575.1
RefSeq Size 974
RefSeq ORF 420
Locus ID 231162

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.