Cldn19 (NM_153105) Mouse Untagged Clone

CAT#: MC213152

Cldn19 (untagged) - Mouse claudin 19 (Cldn19), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cldn19
• Synonyms: MGC141195
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC213152 representing NM_153105
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCAACTCGGGCCTCCAGCTCCTGGGCTACTTCCTAGCCTTGGGCGGCTGGGTGGGCATCATCGCCA
  GCACTGCCCTGCCACAGTGGAAGCAGTCTTCCTATGCAGGCGATGCCATCATCACTGCCGTGGGCCTCTA
  CGAAGGGCTGTGGATGTCTTGCGCCTCTCAGAGCACCGGGCAGGTGCAATGCAAACTCTACGATTCACTC
  CTGGCCCTGGACGGTCATATCCAGTCAGCACGAGCCCTGATGGTCGTGGCTGTGCTCCTGGGCTTTGTGG
  CCATGGTGCTCAGTGTCGTGGGCATGAAGTGCACTCGGGTTGGAGACAGTAACCCCACTGCCAAGAGCCG
  TGTGGCCATCTCCGGAGGTGCTCTCTTCCTCTTGGCAGGTCTCTGTACTTTGACTGCTGTCTCCTGGTAT
  GCTACCCTGGTAACACAGGAATTCTTCAACCCCAGCACTCCTGTCAATGCCAGGTACGAATTTGGCCCAG
  CTCTGTTCGTCGGCTGGGCCTCGGCCGGCCTGGCCATGCTGGGCGGTTCCTTTCTCTGCTGCACATGCCC
  AGAGCCGGAGAGGGCGAACAGCATCCCACAGCCCTATCGCTCTGGACCCTCAACTGCTGCCAGAGAGTAC
  GTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_153105
• ORF Size: 636 bp
• Insert Size: 636
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_153105.7, NP_694745.1
• RefSeq Size: 4236
• RefSeq ORF: 636
• Locus ID: 242653
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. siRNA knockdown of this gene in mice develops the FHHNC (familial hypomagnesemia with hypercalciuria and nephrocalcinosis) symptoms of chronic renal wasting of magnesium and calcium together with defective renal salt handling. The protein encoded by this gene interacts with another family member, Claudin 16, and their interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium. This protein is a constituent of tight junctions in the Schwann cells of peripheral myelinated nerves and the gene deficiency affects the nerve conduction of peripheral myelinated fibers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
  Transcript Variant: This variant (2) has an additional segment in the last splice junction, as compared to variant 1. The transcript is longer but the resulting isoform (2) is shorter at the C-terminus, as compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.