Hist1h2bk (NM_175665) Mouse Untagged Clone

CAT#: MC214391

Hist1h2bk (untagged) - Mouse histone cluster 1, H2bk (Hist1h2bk), (10ug)


  "NM_175665" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hist1h2bk"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hist1h2bk
Synonyms RP23-9O16.11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214391 representing NM_175665
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTGAGCCTGCGAAGTCCGCTCCCGCCCCGAAGAAGGGCTCCAAGAAGGCCGTCACCAAGGCCCAGA
AGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCGGTGTACGTGTACAAGGTGCTGAA
GCAAGTGCACCCCGACACCGGCATCTCCTCCAAGGCCATGGGCATCATGAACTCGTTCGTGAACGACATC
TTCGAGCGCATCGCGAGCGAGGCGTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACGTCCCGGG
AGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGCTGGCCAAGCACGCCGTGTCGGAGGGCACCAA
GGCTGTCACCAAGTATACTAGCGCCAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_175665
ORF Size 381 bp
Insert Size 381
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_175665.2, NP_783596.1
RefSeq Size 500
RefSeq ORF 381
Locus ID 319184
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Aug 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.