Snhg11 (NM_175692) Mouse Untagged Clone

CAT#: MC214406

Snhg11 (untagged) - Mouse small nucleolar RNA host gene 11 (Snhg11), (10ug)


  "NM_175692" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Snhg11"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Snhg11
Synonyms A930034L06Rik; AI854265; AL022637; AW319638; E130013N09Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214406 representing NM_175692
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCCTTTGCCGCAAGGCCCTCTTGACACCAAGGATGACGACGCAAAACCTGCGGCAGCCAACACCCC
TCTCCCCACTCTCCGCACTCACTGGTGGGTGCCACCATCCAGGAAGCAAGTATCCCGAATTGACAGCTTG
GTGCAGAGGGGACATGAGAGGTGTCTCTGTCCAGCTAGGAAGCAGCTGGACCACAGCGCTCCCAAGGAAC
GTACTCCCCAACATCAGTGTGGAGCGACCAGAGAGCATGACCATCTCGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_175692
ORF Size 264 bp
Insert Size 264
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_175692.3, NP_783623.2
RefSeq Size 5864
RefSeq ORF 264
Locus ID 319317

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.