Gchfr (NM_177157) Mouse Untagged Clone

CAT#: MC214461

Gchfr (untagged) - Mouse GTP cyclohydrolase I feedback regulator (Gchfr), (10ug)


  "NM_177157" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gchfr"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gchfr
Synonyms 2010323F13Rik; GFRP; P35
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214461 representing NM_177157
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCTATCTGCTCATCAGCACTCAGATCCGTATGGAGGTGGGCCCCACCATGGTGGGTGATGAACACT
CGGATCCGGAGCTGATGCAGCACCTGGGGGCCTCCAAGAGAAGTGTCTTGGGAAACAACTTTTACGAATA
CTACGTCAACGACCCTCCTCGCATAGTCCTGGACAAGCTGGAATGCAAGGGCTTCCGAGTGCTGAGCATG
ACAGGGGTGGGCCAGACGCTGGTGTGGTGTCTGCACAAGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_177157
ORF Size 255 bp
Insert Size 255
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_177157.4, NP_796131.1
RefSeq Size 629
RefSeq ORF 255
Locus ID 320415

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.