Akain1 (NM_001145192) Mouse Untagged Clone

CAT#: MC214480

A330050F15Rik (untagged) - Mouse RIKEN cDNA A330050F15 gene (A330050F15Rik), (10ug)


  "NM_001145192" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Akain1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Akain1
Synonyms A330050F15Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214480 representing NM_001145192
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGTTCGCTCCAGGTGAGAAGTCTGGGAAGGAGCTAGAGGAGGTGAAGCTGCAGAACACCAGCAAGC
AGATTGTCCAGAATGCCATCCTGCAAGCCATGCGGCAAGTCTCCCAGGAGAGCCTGCGGAGGGAAGGCAG
ACCCGGTGACAGCAGGGCCTGGGGCCAGCTGGGAGGGTGCGAGCTGACCAAGAAACATGAAAAGAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001145192
ORF Size 210 bp
Insert Size 210
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001145192.1, NP_001138664.1
RefSeq Size 2296
RefSeq ORF 210
Locus ID 320722

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.