Bsph1 (NM_001033418) Mouse Untagged Clone

CAT#: MC214586

Bsph1 (untagged) - Mouse binder of sperm protein homolog 1 (Bsph1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Bsph1
• Synonyms: Gm767
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214586 representing NM_001033418
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCCAGCCTTTGGATTTTCTATTGGTTTCAATCTGCCTGTTTCACAGCCTTTTCAGTTTTCAAGTAG
  AAGATTATTATGCACCAACTATAGAGTCTTTAATTAGAAATCCAGAGACAGAAGATGGTGCATGTGTCTT
  TCCGTTCTTGTATAGAAGTGAAATATTCTATGACTGTGTCAATTTCAATCTGAAACACAAGTGGTGTTCT
  TTGAACAAGACTTACCAAGGTTACTGGAAATACTGTGCTCTTTCAGACTATGCTCCATGTGCCTTTCCCT
  TCTGGTACAGACATATGATCTACTGGGATTGCACAGAGGATGGAGAGGTGTTTGGGAAAAAGTGGTGTTC
  ACTCACCCCAAATTACAACAAAGACCAAGTTTGGAAATATTGTATAGAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033418
• Insert Size: 402 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033418.4, NP_001028590.1
• RefSeq Size: 823 bp
• RefSeq ORF: 402 bp
• Locus ID: 330470
• Cytogenetics: 7 A1
• Gene Summary: This gene encodes a member of the binder of sperm family. The encoded protein may be involved in sperm capacitation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).