Tmsb15b2 (NM_001080967) Mouse Untagged Clone

CAT#: MC215457

Tmsb15b2 (untagged) - Mouse thymosin beta 15b2 (Tmsb15b2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tmsb15b2
• Synonyms: Tb15c
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC215457 representing NM_001080967
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCGATAAACCAGACTTGTCAGAAGTTGAAACATTTGACAAAGCAAAGTTGAAGAAAACTAATACTG
  AAGTAAAAAATACTCTTCCGTCGAAGGAAACTATCCAGCAAGAGAAAGAACACAATGAAAGAACATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080967
• ORF Size: 138 bp
• Insert Size: 138
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001080967.4, NP_001074436.1
• RefSeq Size: 691
• RefSeq ORF: 138
• Locus ID: 100034363
• Gene Summary: This gene is part of tandem duplication; the other copy of this gene is about 1.5 kb away. Readthrough transcripts that include two exons transcribed from each gene exist. [provided by RefSeq, Jul 2008]