Cttn (NM_007803) Mouse Untagged Clone

CAT#: MC218796

Cttn (untagged) - Mouse cortactin (Cttn), (10ug)


  "NM_007803" in other vectors (2)

Reconstitution Protocol

USD 740.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cttn"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cttn
Synonyms 1110020L01Rik; Ems1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218796 representing NM_007803
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_007803
ORF Size 1641 bp
Insert Size 1641
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_007803.4, NP_031829.2
RefSeq Size 3029
RefSeq ORF 1641
Locus ID 13043

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.