Tbx4 (NM_011536) Mouse Untagged Clone

CAT#: MC218820

Tbx4 (untagged) - Mouse T-box 4 (Tbx4), transcript variant 1, (10ug)


  "NM_011536" in other vectors (4)

Reconstitution Protocol

USD 740.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Tbx4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tbx4
Synonyms 3930401C23
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218820 representing NM_011536
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_011536
ORF Size 1659 bp
Insert Size 1659
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_011536.2, NP_035666.2
RefSeq Size 3011
RefSeq ORF 1659
Locus ID 21387
Gene Summary Involved in the transcriptional regulation of genes required for mesoderm differentiation. Probably plays a role in limb pattern formation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.