Ar (NM_013476) Mouse Untagged Clone
CAT#: MC222457
Ar (untagged) - Mouse androgen receptor (Ar), (10ug)
"NM_013476" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Symbol | Ar |
| Synonyms | AW320017; Tfm |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC222457 representing NM_013476
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-RsrII |
| ACCN | NM_013476 |
| ORF Size | 2700 bp |
| Insert Size | 2700 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_013476.3, NP_038504.1 |
| RefSeq Size | 2999 |
| RefSeq ORF | 2700 |
| Locus ID | 11835 |
| Gene Summary | This gene encodes a nuclear hormone receptor containing zinc finger and DNA-binding domains. The encoded protein is a key regulator of signalling by androgens, a class of steroid hormones involved in male reproductive development. The protein responds to hormone signalling by translocating to the nucleus, forming dimers, and binding to androgen response elements (AREs) in the promoters of target genes, which are subsequently transcriptionally activated. Activity of this protein is negatively regulated by nuclear receptor subfamily 0 group B member 1 (Nr0b1, also known as Dax1). Mutations in this gene result in feminized genitals and infertility in male animals. Loss of function in female animals also causes problems in reproductive development and function. [provided by RefSeq, May 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR226737 | Ar (Myc-DDK-tagged) - Mouse androgen receptor (Ar) |
USD 851.00 |
|
| MG226737 | Ar (GFP-tagged) - Mouse androgen receptor (Ar), (10ug) |
USD 830.00 |
|
| MR226737L3 | Lenti ORF clone of Ar (Myc-DDK-tagged) - Mouse androgen receptor (Ar) |
USD 1,176.00 |
|
| MR226737L4 | Lenti ORF clone of Ar (mGFP-tagged) - Mouse androgen receptor (Ar) |
USD 1,176.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China
