Ar (NM_013476) Mouse Untagged Clone

CAT#: MC222457

Ar (untagged) - Mouse androgen receptor (Ar), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ar
• Synonyms: AW320017; Tfm
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC222457 representing NM_013476
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_013476
• ORF Size: 2700 bp
• Insert Size: 2700
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_013476.3, NP_038504.1
• RefSeq Size: 2999
• RefSeq ORF: 2700
• Locus ID: 11835
• Gene Summary: This gene encodes a nuclear hormone receptor containing zinc finger and DNA-binding domains. The encoded protein is a key regulator of signalling by androgens, a class of steroid hormones involved in male reproductive development. The protein responds to hormone signalling by translocating to the nucleus, forming dimers, and binding to androgen response elements (AREs) in the promoters of target genes, which are subsequently transcriptionally activated. Activity of this protein is negatively regulated by nuclear receptor subfamily 0 group B member 1 (Nr0b1, also known as Dax1). Mutations in this gene result in feminized genitals and infertility in male animals. Loss of function in female animals also causes problems in reproductive development and function. [provided by RefSeq, May 2015]