Gng2 (NM_001285908) Mouse Untagged Clone

CAT#: MC225511

Gng2 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 2 (Gng2), transcript variant 3


  "NM_001285908" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gng2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gng2
Synonyms 82
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225511 representing NM_001285908
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAACAGCTGAAGATGGAAGCCA
ACATCGACAGGATAAAGGTGTCCAAGGCAGCTGCTGACTTGATGGCCTACTGTGAGGCACATGCCAAGGA
AGACCCTCTGCTGACCCCAGTCCCAGCCTCAGAAAACCCCTTTCGGGAGAAGAAGTTCTTCTGCGCCATC
CTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285908
ORF Size 216 bp
Insert Size 216
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001285908.1, NP_001272837.1
RefSeq Size 3638
RefSeq ORF 216
Locus ID 14702
Gene Summary Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1-6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.