Lsm2 (NM_001204274) Mouse Untagged Clone

CAT#: MC225516

Lsm2 (untagged) - Mouse LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) (Lsm2), transcript variant 4


  "NM_001204274" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Lsm2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lsm2
Synonyms D17H6S56E-2; D17H6S56E2; Dmapl; Dmpkap; G7b; Sm-X5; SmX5; snRNP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225516 representing NM_001204274
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCTTCTACTCCTTTTTCAAGTCTCTTGTGGGCAAGGATGTAGTCGTGGAACTCAAGAATGACCTGA
GCATCTGTGGAACCCTCCACTCTGTGGACCAGTACCTCAATATCAAACTAACCGACATCAGTGTCACAGA
CCCTGAGAAATACCCTCACTTCCCCATTGGTGACCCAGAACTTGACGTCCTACTGAGGACAAGAACACCC
CTGCCCAATACTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001204274
ORF Size 225 bp
Insert Size 225
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001204274.1, NP_001191203.1
RefSeq Size 713
RefSeq ORF 225
Locus ID 27756

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.