Gng4 (NM_001302997) Mouse Untagged Clone

CAT#: MC225517

Gng4 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 4 (Gng4), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gng4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225517 representing NM_001302997
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGGAAGGCATGTCTAATAACAGCACCACCAGCATCTCCCAGGCCAGGAAAGCCGTGGAGCAGCTGA
  AGATGGAAGCCTGCATGGACAGGGTGAAGGTCTCCCAGGCTGCCTCAGACCTCCTGGCCTACTGTGAAGC
  CCACGTGCGGGAGGACCCCCTCATCATCCCAGTGCCTGCCTCAGAAAACCCCTTCCGGGAGAAGAAGTTC
  TTCTGCACCATCCTCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302997
• ORF Size: 228 bp
• Insert Size: 228
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001302997.1, NP_001289926.1
• RefSeq Size: 2912
• RefSeq ORF: 228
• Locus ID: 14706
• Gene Summary: This gene encodes the gamma subunit of the heterotrimeric G-proteins that are comprised of alpha, beta and gamma subunits. Upon activation by G protein-coupled receptors, the beta-gamma heterodimer dissociates from the alpha subunit to activate downstream signaling events. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.