Pkib (NM_001039050) Mouse Untagged Clone

CAT#: MC225528

Pkib (untagged) - Mouse protein kinase inhibitor beta, cAMP dependent, testis specific (Pkib), transcript variant 2


  "NM_001039050" in other vectors (2)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pkib"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pkib
Synonyms Pkibeta; Prkacn2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225528 representing NM_001039050
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGACAGATTCATCAGAGATGACTGATGTGGAATCTGTGATCACCAGCTTTGCGTCCTCAGCAAGGG
CAGGCCGCCGCAATGCCTTACCCGACATCCAGAGTTCACTGGCTACAAGTGGATCCTCTGATCTTCCACT
GAAACTGGAAGCGTTGGCCGTGAAGGAAGATGCAAAAACGAAGAATGAAGAGAAAGACCAAGGCCAACCA
AAAACACCCCTAAATGAAGGAAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001039050
ORF Size 237 bp
Insert Size 237
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001039050.1, NP_001034139.1
RefSeq Size 5581
RefSeq ORF 237
Locus ID 18768

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.