Scoc (NM_001285992) Mouse Untagged Clone

CAT#: MC225535

Scoc (untagged) - Mouse short coiled-coil protein (Scoc), transcript variant 3


  "NM_001285992" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Scoc"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Scoc
Synonyms 0610011C06Rik; 2810002J11Rik; AA415030; SCOCO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225535 representing NM_001285992
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGAATGCTGACATGGACGTTGATGCTGAAAATCAGGTGGAACTGGAAGAAAAGACTCGACTTATTA
ATCAGGTGTTGGAACTCCAACACACACTTGAAGATCTTTCTGCAAGAGTAGATGCAGTTAAGGAAGAAAA
TCTGAAGCTAAAGTCGGAAAATCAAGTTCTCGGACAATATATAGAAAACCTCATGTCTGCTTCTAGTGTT
TTTCAAACAACTGATACAAAAAGCAAAAGGAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285992
ORF Size 246 bp
Insert Size 246
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001285992.1, NP_001272921.1
RefSeq Size 1943
RefSeq ORF 246
Locus ID 56367

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.