Dph3 (NM_001284346) Mouse Untagged Clone

CAT#: MC225539

Dph3 (untagged) - Mouse diphthamine biosynthesis 3 (Dph3), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dph3
• Synonyms: DELGIP1; DelgipP1; Desr1; KTI11; Zcsl2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225539 representing NM_001284346
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGTGTTTCACGACGAGGTGGAGATCGAGGACTTTCAATATGACGAGGACTCGGAGACATATTTCT
  ACCCTTGCCCCTGTGGGGATAACTTTGCCATCACCAAGGAAGATTTGGAAAATGGAGAAGATGTGGCCAC
  GTGTCCTAGCTGCTCACTCATTATAAAAGTGATTTATGACAAAGATCAGTTCATGTGTGGAGAAACAGTC
  CCAGCACCTTCAACCAACAAGGAGTTAGTTAAATGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001284346
• ORF Size: 249 bp
• Insert Size: 249
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001284346.1, NP_001271275.1
• RefSeq Size: 1189
• RefSeq ORF: 249
• Locus ID: 105638
• Gene Summary: Essential for the first step in the synthesis of diphthamide, a post-translational modification of histidine which occurs in elongation factor 2. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 3' UTR, compared to variant 1. Both variants 1 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.