Zfp82 (NM_001253385) Mouse Untagged Clone

CAT#: MC225546

Zfp82 (untagged) - Mouse zinc finger protein 82 (Zfp82), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Zfp82
• Synonyms: A030010D05; Krab16; Mszf3; Zfp-82
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225546 representing NM_001253385
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCCGTGTGTCAGTGGTGTTCAGTGATGTGTCCATAGCCTTCTCGCAGGAGGAGTGGGAGTCCCTGG
  ACTTAGAACAGAGGAATTTGTACAAGGATGTGATGATGGAGAACTACCACAATGTGGCCTCGCTAGGATG
  CTTCATTTCTAAGCCAGATGTGATTTCCTTACTGGAGCAAGGGAAAGAGCCCTGGAAGGTTGTGAGGCAA
  AGAAAACCATGTCCAGCCAGGCGTGACGGTGCAAGCCTGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253385
• ORF Size: 252 bp
• Insert Size: 252
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001253385.1, NP_001240314.1
• RefSeq Size: 1910
• RefSeq ORF: 252
• Locus ID: 330502
• Gene Summary: May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains an alternate terminal exon and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct and significantly shorter C-terminus, compared to isoform 1.