Zfp82 (NM_001253385) Mouse Untagged Clone

CAT#: MC225546

Zfp82 (untagged) - Mouse zinc finger protein 82 (Zfp82), transcript variant 3


  "NM_001253385" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Zfp82"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zfp82
Synonyms A030010D05; Krab16; Mszf3; Zfp-82
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225546 representing NM_001253385
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCGTGTGTCAGTGGTGTTCAGTGATGTGTCCATAGCCTTCTCGCAGGAGGAGTGGGAGTCCCTGG
ACTTAGAACAGAGGAATTTGTACAAGGATGTGATGATGGAGAACTACCACAATGTGGCCTCGCTAGGATG
CTTCATTTCTAAGCCAGATGTGATTTCCTTACTGGAGCAAGGGAAAGAGCCCTGGAAGGTTGTGAGGCAA
AGAAAACCATGTCCAGCCAGGCGTGACGGTGCAAGCCTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253385
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001253385.1, NP_001240314.1
RefSeq Size 1910
RefSeq ORF 252
Locus ID 330502
Gene Summary May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an alternate terminal exon and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct and significantly shorter C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.