C1qtnf6 (NM_001204153) Mouse Untagged Clone

CAT#: MC225559

C1qtnf6 (untagged) - Mouse C1q and tumor necrosis factor related protein 6 (C1qtnf6), transcript variant 3


  "NM_001204153" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "C1qtnf6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol C1qtnf6
Synonyms 2810036M19Rik; Adiq; CTRP6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225559 representing NM_001204153
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGGTCATCATGGGGATAGCCAGCCTGGGGTTCCTCTGGGCAGTATTCCTGCTTCCTCTTGTGTTTG
GGGTCCCCACAGAGGAGACTACCTTTGGAGAATCTGTGGCCTCCCATCTCCCCAAAGGCTGTCGACGATG
CTGTGACCCCGAGGACCTGATGTCCTCTGATGATACGGTCCAGGCCCCTGTTTCCCCTTATGTCCTGCCT
GAAGTCAGGCCGTACATCAACATTACTATCCTAAAGGGGTCTTTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001204153
ORF Size 258 bp
Insert Size 258
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001204153.1, NP_001191082.1
RefSeq Size 2217
RefSeq ORF 258
Locus ID 72709

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.