Smim22 (NM_001253803) Mouse Untagged Clone

CAT#: MC225562

Smim22 (untagged) - Mouse small integral membrane protein 22 (Smim22), transcript variant 4


  "NM_001253803" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Smim22"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Smim22
Synonyms EG432995; Gm5480
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225562 representing NM_001253803
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGCTTTCTGATGAGGAGCTGAGGCAGGAGCTGCAGGCCACTGCAGAGGAAGTACTGGGGAGGCTGA
GGAGCCGGCAGCTCTTCCAGTCGGAATGGGACGTCGCTGCCTTTGTGGTCTTTCTCACATTTGTGGGCAC
TGTGCTGTTGTTGCTGTTGCTGGTCTTTGTCCATTGCTGCTGTTGTTGCTGCTGCAACACCTCCCCCAGG
CCCCGGAAGGAAAAGCGCAATGGTGTGGATAACTTGGCCCTGGAACCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253803
ORF Size 261 bp
Insert Size 261
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001253803.1, NP_001240732.1
RefSeq Size 370
RefSeq ORF 261
Locus ID 432995

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.