Mdk (NM_001291483) Mouse Untagged Clone

CAT#: MC225563

Mdk (untagged) - Mouse midkine (Mdk), transcript variant 6

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mdk
• Synonyms: Mek; MK
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225563 representing NM_001291483
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGCACCGAGGCTTCTTCCTTCTCGCCCTTCTTGCCCTCTTGGTGGTCACGTCCGCGGTGGCCAAAA
  AAAAAGAGAAGGTGAAGAAGGGCAGCGAGTGTTCGGAGTGGACCTGGGGGCCCTGCACCCCCAGCAGCAA
  GGACTGCGGCATGGGCTTCCGCGAGGGTACCTGTGGGGCCCAGACCCAGCGCGTCCATTGCAAGGTGCCC
  TGCAACTGGAAGAAGGAATTTGGAGCCAAGAAAGGAAAAGGAAAGGACTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291483
• ORF Size: 261 bp
• Insert Size: 261
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001291483.1, NP_001278412.1
• RefSeq Size: 915
• RefSeq ORF: 261
• Locus ID: 17242
• Gene Summary: This gene encodes a secreted growth factor that belongs to the pleiotrophin/midkine heparin-binding protein family and functions in a variety of biological processes. The encoded cytokine promotes the growth, differentiation, survival and migration of several target cells including leucocytes involved in inflammation. This protein plays a role in the formation of scar tissue and intraperitoneal adhesions, and promotes neurite outgrowth and neuron survival. The protein encoded by this gene is associated with obesity and inhibition of insulin signaling in fat cells. A pseudogene of this gene is present on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (6) lacks an alternate in-frame exon in the central coding region compared to variant 1. The encoded isoform (c) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.