Tmem216 (NM_001277861) Mouse Untagged Clone

CAT#: MC225568

Tmem216 (untagged) - Mouse transmembrane protein 216 (Tmem216), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tmem216
• Synonyms: 1110017C22Rik; 2810441K11Rik; 4921533J23Rik; A930021F15Rik; AI482550
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225568 representing NM_001277861
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGCTGCTCTATCTTGGCATTGAAGTCATACGATTGTTTTTCGGTACAAAGGGAAACCTCTGCCAGC
  GAAAGATGCCCCTTGGCATTAGTGTGGCCTTGACCTTCCCATCCGCTATGATGGCTTCCTATTACCTGCT
  GCTGCAGACCTACGTGCTCCGCCTAGAAGCTATCATGAACAGTATCTTGCTCTTCTTTTGTGGCTCAGAG
  CTGCTGCTTGAGATGCTCACGCTGGCCACCTTCTCCAGCATGGACAGGATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277861
• ORF Size: 264 bp
• Insert Size: 264
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001277861.1, NP_001264790.1
• RefSeq Size: 1042
• RefSeq ORF: 264
• Locus ID: 68642
• Gene Summary: This gene encodes a transmembrane protein which is involved in regulation of signaling and trafficking of associated proteins. In humans, mutations in this gene are associated with ciliopathies including Joubert, Meckel and related syndromes. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
  Transcript Variant: This variant (3) contains an alternate 5' terminal exon, differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.