Ypel1 (NM_001291053) Mouse Untagged Clone

CAT#: MC225570

Ypel1 (untagged) - Mouse yippee-like 1 (Drosophila) (Ypel1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ypel1
• Synonyms: 0610009L05Rik; 1700016N17Rik; 1700019O22Rik; 4921520K19Rik; 4930511F14Rik; AV118478; DGL-1; Dgl1; mdgl-1; Ppil2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225570 representing NM_001291053
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCGCAGCGGACCGCGGAGCGGCCTCCTTTCAGGGAAGCCAGGGGCGAGCCTACCTCTTCAACTCTG
  TGGTGAATGTGGGCTGTGGCCCCGCTGAGGAGAGAGTCCTTCTAACCGGGCTGCATGCAGTGGCCGACAT
  CTACTGTGAGAACTGCAAGACCACACTCGGGTGGAAATACGAACATGCCTTTGAGAGCAGTCAGAAATAC
  AAGGAAGGAAAATTTATTATTGAACTTGCCCACATGATCAAAGACAACGGCTGGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291053
• ORF Size: 267 bp
• Insert Size: 267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001291053.1, NP_001277982.1
• RefSeq Size: 2599
• RefSeq ORF: 267
• Locus ID: 106369
• Gene Summary: May play a role in epithelioid conversion of fibroblasts. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks two alternate exons in the 5' UTR and 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.